ID: 907540791

View in Genome Browser
Species Human (GRCh38)
Location 1:55214629-55214651
Sequence GAGAAGCCCCAGGCTCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907540791 Original CRISPR GAGAAGCCCCAGGCTCCAGT TGG (reversed) Intronic
900097503 1:945962-945984 GGGAAGCCCCAGGCTGCACTAGG - Intronic
900832790 1:4977221-4977243 GAGGGGGCCCTGGCTCCAGTCGG - Intergenic
901260349 1:7866228-7866250 GAGGAGGCCCAGCCTCCAGATGG - Intergenic
901910434 1:12453098-12453120 GAGAACACCCAGGACCCAGTTGG + Intronic
903018610 1:20378061-20378083 GTGGAGCCCCAGCCTCCACTAGG + Intergenic
903938590 1:26913455-26913477 GCTAAGCTCCAGGCTCCAGAAGG + Exonic
906194448 1:43921082-43921104 GAGAAGGCCCTGGGTTCAGTGGG - Intronic
907540791 1:55214629-55214651 GAGAAGCCCCAGGCTCCAGTTGG - Intronic
907588208 1:55640425-55640447 GAGAAGCTCCAGTCTCCAGCAGG - Intergenic
907934995 1:59034017-59034039 GAAATCACCCAGGCTCCAGTGGG + Intergenic
910851281 1:91651769-91651791 GAGGAGGCCCAGGCTCCATGCGG - Intergenic
913501466 1:119476224-119476246 GAAAAGCCACAGGAGCCAGTGGG + Intergenic
913516804 1:119611991-119612013 GAAAAGCCACAGGAGCCAGTGGG + Intergenic
913690099 1:121271382-121271404 GAGAACACCCAGGAACCAGTGGG - Intronic
914147441 1:145008581-145008603 GAGAACACCCAGGAACCAGTGGG + Intronic
915354508 1:155248074-155248096 GGAAAGCCCCAGACCCCAGTGGG - Exonic
915512250 1:156392708-156392730 GAGAAGCCCAAGCCCCCAGCTGG - Intergenic
915674562 1:157518299-157518321 AAGAAGCCCCATGACCCAGTGGG + Intronic
919449168 1:197749919-197749941 CAGGAGCTCCAGGCTGCAGTGGG - Intronic
920477421 1:206289863-206289885 GAGAACACCCAGGAACCAGTGGG - Intronic
921348545 1:214211952-214211974 CAGCAGCCCCAGGTTCCAGAGGG + Intergenic
922470017 1:225870811-225870833 GGGAAGCCCCAGGCTCCAGCAGG + Intronic
924777346 1:247119342-247119364 GAGAAGGCCCAGGACCCAGCTGG - Intergenic
1062862708 10:822811-822833 GAGGAGCCCCAGGCGCCAGGTGG - Intronic
1064003894 10:11685088-11685110 GAGAAGCCCCCGGCTCCATCAGG + Intergenic
1064136569 10:12755764-12755786 GAGAAACCCCAAGGTCCAGAAGG - Intronic
1065789063 10:29243104-29243126 GAGAAGCCCCCGTCTCAACTAGG + Intergenic
1067546880 10:47198264-47198286 CAGAAGCCGCAGCCTCCTGTGGG - Intergenic
1068009746 10:51433394-51433416 GAGAATCCCAAGGCTCCAAGAGG - Intronic
1069921651 10:71819228-71819250 GGGAGGCCCCAGGACCCAGTGGG - Intronic
1070135869 10:73693194-73693216 GAGAAGCCCATGGCTCCGGAAGG + Intronic
1071517232 10:86306244-86306266 CTGGAGCCCCAGGCCCCAGTTGG + Intronic
1072427943 10:95345908-95345930 GAGAAACGCCAGTCTCCTGTGGG + Intronic
1074383151 10:112996463-112996485 GGGAAACCCCAGGATCCAGATGG + Intronic
1075975650 10:126691822-126691844 TAAAATCCCCAGGCTCCACTGGG - Intergenic
1076540025 10:131207909-131207931 GAGAGACCCAAGGCTCCAGGCGG + Intronic
1076616885 10:131760830-131760852 GAGACACCCCATGCTCCAGTGGG + Intergenic
1077111350 11:863565-863587 GAGGAGCTCCAAGCCCCAGTAGG - Intronic
1078891116 11:15560014-15560036 CAGGAGCACCAGGCTCCAGGTGG - Intergenic
1078900990 11:15642683-15642705 GAGAATCCCCAGGATGCTGTAGG - Intergenic
1079136878 11:17780393-17780415 GAGAAGCCTCTCTCTCCAGTGGG - Intronic
1083222075 11:61259019-61259041 GGGAGGCCCCAGGCTCCCCTGGG + Exonic
1083869483 11:65477953-65477975 GAGACGCCTCAGGCACCAGGTGG - Intergenic
1083880150 11:65544364-65544386 GATAAGCCCTGGGCTCCAGCTGG - Intronic
1084074829 11:66765434-66765456 GAGAAGACTTAGGCTACAGTTGG - Intronic
1084288524 11:68146973-68146995 GAGTAGCCCGAGGCTCCAAGTGG - Intergenic
1085340446 11:75727858-75727880 GAAAAACCCCAGGCCTCAGTAGG + Intronic
1086834735 11:91606668-91606690 CAGAAGGCCCAGGGACCAGTTGG - Intergenic
1087150068 11:94851229-94851251 GAGAAGCCCCAGCCTCCCTTAGG - Intronic
1088448621 11:109958991-109959013 GGGAAGCTCCAGCCTCCAGAAGG + Intergenic
1090698071 11:129268803-129268825 GAGAAGTCACAGGATCCAGCTGG - Intronic
1090803827 11:130190327-130190349 GAGACGCCCCAGGCTGCCCTGGG - Intronic
1090919588 11:131196180-131196202 GAGAAGCTCCAGAAGCCAGTAGG + Intergenic
1091125372 11:133091015-133091037 GAGAAGCCCAGGGCACCTGTGGG + Intronic
1091171307 11:133521839-133521861 GAGAAGCCAAAGGCTTCTGTAGG + Intronic
1092503861 12:9074735-9074757 CAGAAACCCAAGGCACCAGTGGG - Exonic
1095726241 12:45456039-45456061 AAGAACCCCCAGACTACAGTGGG + Intergenic
1096101273 12:48971759-48971781 GGGAAGCCCCAGGCTCGGGGAGG - Exonic
1096153612 12:49329958-49329980 CAGAACCCCCAGCCTCCAGGAGG + Exonic
1099315439 12:81077928-81077950 GAGAAGCAACAGGCTAAAGTGGG - Exonic
1100534088 12:95490173-95490195 CAGAAGTTCCAGGCTACAGTGGG - Intronic
1101044923 12:100794925-100794947 GTGAACCTCCAGGCTCCAGTCGG - Intronic
1102622358 12:114206298-114206320 GGAAAGCCCAAGGCTCCAGATGG + Intergenic
1103170968 12:118819577-118819599 GTGAAGCCCCATGGTGCAGTTGG - Intergenic
1103342146 12:120226330-120226352 GTGAAGCTCCTGGCCCCAGTGGG - Intronic
1103358989 12:120342590-120342612 GTGAAGCCCCAGGCCGCAGGGGG - Exonic
1104013992 12:124950358-124950380 GAGAAGCCCACGGCTGCAGGAGG + Intronic
1104574547 12:129955091-129955113 GAGAGGCCACAGGCTCCTGCTGG - Intergenic
1104870067 12:131988685-131988707 TAGAAACCCCAGGCCTCAGTGGG + Intronic
1105329542 13:19402818-19402840 CAGAAGCGCCGGGCTCCAGGGGG - Intergenic
1105862292 13:24426215-24426237 CAGAAGCGCCAGCCTCCAGCGGG + Intronic
1107437311 13:40391443-40391465 GATAAGCCCCAGGAGCCAGGAGG + Intergenic
1108578765 13:51811218-51811240 GAGAACTCTCAGGCTCCAGCTGG + Intergenic
1109621556 13:64914002-64914024 GACAAGGCCAAGGCTCAAGTCGG - Intergenic
1112478530 13:99753376-99753398 CAGAGGCCCCAGGAACCAGTCGG + Intronic
1113578198 13:111409493-111409515 GAGAAGCCCCAGATTTCAGGTGG + Intergenic
1113853246 13:113429772-113429794 GAAAAGCCCCAAGCACCAGCAGG - Intronic
1115105681 14:29758802-29758824 GAGAAGTCCCTGTCTCCAGATGG + Intronic
1119804905 14:77476203-77476225 GAGAAGGCCCAGGCCCCAGCTGG + Intronic
1122544258 14:102513498-102513520 GAGAGGCCCGAGGCCCCAGCCGG + Intergenic
1123998400 15:25734492-25734514 GGGAATCCCCAGGCACGAGTTGG - Intronic
1128260454 15:66229316-66229338 CACAAGCCCCAGGCTCCCGGTGG + Intronic
1129120063 15:73390821-73390843 GAGAAGCACATGGCCCCAGTTGG - Intergenic
1129965607 15:79732519-79732541 GAGAAGCCCAAGGGACCACTAGG + Intergenic
1130322977 15:82855576-82855598 GAGAAGGCACAGGTTACAGTGGG - Intronic
1131505505 15:93014745-93014767 CAGAGGCCTCAGGCTCCAGCCGG + Exonic
1132938132 16:2492433-2492455 GAGCAGCACCAGCCTCCACTCGG - Intronic
1133017313 16:2950020-2950042 GAGAGGCCACAGGCTGCAGCTGG - Exonic
1134062936 16:11209938-11209960 GAGGGGCCCAGGGCTCCAGTGGG + Intergenic
1134110788 16:11514364-11514386 GAGATGCCCCAAGATCCAGCGGG - Exonic
1137555001 16:49464992-49465014 GAGAGGCCCCGGGGCCCAGTAGG + Intergenic
1139298055 16:65920044-65920066 CAGAAGCCCCAAGCTGGAGTGGG + Intergenic
1139482275 16:67237061-67237083 AAGAAGCCCCAGGCGCTGGTGGG - Exonic
1140218669 16:73028104-73028126 GAGAAGCCGCAGGGTCCCGGAGG - Intronic
1142108498 16:88318829-88318851 GAGAAGCCCCAGCGTCCAGACGG + Intergenic
1142222932 16:88864299-88864321 GAGGACACCCAGGCTCCAGGGGG - Exonic
1144716648 17:17440767-17440789 GAGAAGGCCCAGGGTACAGGGGG - Intergenic
1145303256 17:21655001-21655023 GCTAAGCCTCAGGCTCCAGGTGG - Intergenic
1145346782 17:22046841-22046863 GCTAAGCCTCAGGCTCCAGGTGG + Intergenic
1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG + Exonic
1146953794 17:36924082-36924104 GATAAGGCACAGGCTCCAGGAGG - Intergenic
1147343088 17:39766844-39766866 CAGAAGTCCCAGGCTCCTGTGGG - Intronic
1148216183 17:45835115-45835137 GGGCAGCCCCAGGGCCCAGTGGG - Exonic
1148216595 17:45836833-45836855 GACAAGGCCCGGGCTGCAGTGGG - Intergenic
1149439110 17:56660501-56660523 CAGTGGCCTCAGGCTCCAGTAGG + Intergenic
1150991989 17:70270327-70270349 GAGACGGCCCAGGCTTGAGTAGG + Intergenic
1151560200 17:74865903-74865925 GGGAAGCCCCAGGGCACAGTGGG - Intronic
1151705418 17:75764713-75764735 GAGGAGCCCCAGCCCCCAGAGGG + Intronic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1151822082 17:76501864-76501886 GAGAGGCCTCAGGGTCCAGGAGG - Intergenic
1152757290 17:82092344-82092366 GGGAAGCCCCCGCCTCCACTTGG + Intronic
1153893322 18:9537882-9537904 GAGCAGCTCCTGGCTCCGGTGGG + Exonic
1154085603 18:11302849-11302871 CAGAAGCGCAAGGCTGCAGTGGG - Intergenic
1155187272 18:23397986-23398008 CAGAAGGTCGAGGCTCCAGTGGG + Intronic
1155353643 18:24930025-24930047 GAGAAGCCCCAGTGTCTAGATGG + Intergenic
1155790473 18:29962134-29962156 AAAAAGCCCCAGCCTCCAGTAGG + Intergenic
1155947135 18:31867643-31867665 GAGTAGACCCAGGCTGTAGTAGG + Intronic
1156403352 18:36760393-36760415 GAAAAGCCCCCGGCCCCAGAAGG - Intronic
1160027631 18:75231374-75231396 GAGAAGCCCCAGGCCAGAGAAGG - Intronic
1160658575 19:287758-287780 GAGCAGCCGCAGGAACCAGTGGG + Intronic
1160715062 19:572775-572797 CCGAGGCCCCAGGCTCCCGTCGG - Intronic
1161074517 19:2278885-2278907 GACAAGAGCCAGGCTGCAGTGGG - Exonic
1161137105 19:2626312-2626334 GAGATGCCCCAGCCTCCTGTGGG - Intronic
1161560824 19:4971617-4971639 GAGGAGTCCCTGGCTCCTGTGGG + Intronic
1162373036 19:10290241-10290263 GAGAAGACTCAGGCTCGAGGTGG - Intronic
1163482589 19:17566719-17566741 CAGAAACTCCAGGCTGCAGTGGG + Intronic
1164155744 19:22596028-22596050 GCGGGGCCGCAGGCTCCAGTGGG - Intergenic
1164491151 19:28715228-28715250 GAGGTCCCCCAGGCTCCAGGTGG - Intergenic
1164923295 19:32105827-32105849 GAGAGCCTCCAGGCTCCAGAAGG + Intergenic
1165012147 19:32856677-32856699 CAGAAGTTCCAGGCTGCAGTGGG - Intronic
1165428533 19:35758566-35758588 TACAAGCCCCAGGATCCACTGGG - Intronic
1166939714 19:46355403-46355425 GAGAAGCACGAGTCTGCAGTCGG + Intronic
1167317185 19:48771275-48771297 GAGAGGTCCCAGACTCCATTAGG + Intergenic
1167363394 19:49042275-49042297 GAAAGGCCCCAGTCTCCAGCAGG - Intergenic
1167367349 19:49061796-49061818 GAAAGGCCCCAGCCTCCAGCAGG + Exonic
1167531216 19:50018137-50018159 GAGAAGCCCCATTTTACAGTGGG - Intronic
1167743469 19:51338067-51338089 GGGAGGCCCCTGGCTCCAGGAGG - Exonic
1168108550 19:54179375-54179397 GAGATGTTCCAGGCGCCAGTGGG + Intronic
925410479 2:3637049-3637071 GAAAAGCCCCTGGCTCCTCTCGG - Intronic
927136248 2:20098440-20098462 GGGAAACACCAGGCTTCAGTTGG + Intergenic
929536380 2:42786939-42786961 GAGTCTCCCCAGGCTCCAGCTGG + Intronic
930957095 2:57216762-57216784 AAGATGCCACAGGCTGCAGTGGG + Intergenic
932136007 2:69229149-69229171 TTGAAGCCTCAGCCTCCAGTGGG - Intronic
934623585 2:95831433-95831455 GAGTAGCAGCAGGCCCCAGTTGG - Intergenic
934810165 2:97270662-97270684 GAGTAGCTGCAGGCCCCAGTTGG + Intergenic
934827527 2:97437277-97437299 GAGTAGCTGCAGGCCCCAGTTGG - Intergenic
936156254 2:110049198-110049220 GAGAGGCTCCAGGTTCCAGTGGG + Intergenic
936188434 2:110322230-110322252 GAGAGGCTCCAGGTTCCAGTGGG - Intergenic
936595691 2:113845434-113845456 CAGAAGGTCCAGGCTGCAGTGGG - Intergenic
937910988 2:127075621-127075643 GAGAGGCCCCAGGGCCAAGTTGG - Intronic
939268842 2:139912052-139912074 GAGGAGGCCCAGTCTCCAGTCGG + Intergenic
942313878 2:174681643-174681665 GTGTAGCCCCAGACTCCCGTCGG - Intronic
946128017 2:217581407-217581429 TAGAAGACCCAGGTTCCATTTGG - Intronic
947142701 2:227034139-227034161 GAGAAGGCACAGGCATCAGTGGG - Intronic
948717062 2:239871900-239871922 CAGGAGCACCAGGCCCCAGTGGG + Intergenic
1169283783 20:4290161-4290183 TGGAAGCCCCAGCCTCCAGAAGG + Intergenic
1171013531 20:21521588-21521610 GAGAAGCCCCTGTCTCCACTGGG + Intergenic
1171069637 20:22055608-22055630 TGGAAGCACGAGGCTCCAGTGGG + Intergenic
1172091117 20:32433641-32433663 GAGAAGCCACAGACTCAACTGGG - Exonic
1172703441 20:36865843-36865865 CAGATGCCCCTGGCTCTAGTAGG + Intergenic
1172776171 20:37408311-37408333 GACATGCCCCAGACTCCAGGCGG - Intergenic
1174269374 20:49356099-49356121 GCTAGGCCCCAGGCTGCAGTGGG + Intergenic
1176011735 20:62900476-62900498 GAGTAGCACCATCCTCCAGTGGG - Intronic
1176063633 20:63183020-63183042 GAGGCGCCCCAGAATCCAGTGGG + Intergenic
1176310521 21:5146580-5146602 GGGAGGCCCCAGGCTGCAGGCGG - Intronic
1176551788 21:8226305-8226327 GAGAAGCCCAAGGCTACGGAAGG - Intergenic
1176570697 21:8409304-8409326 GAGAAGCCCAAGGCTACGGAAGG - Intergenic
1176578606 21:8453451-8453473 GAGAAGCCCAAGGCTACGGAAGG - Intergenic
1179675846 21:42981631-42981653 CAGAAGCTCCCGGCTGCAGTGGG - Intronic
1179846534 21:44115455-44115477 GGGAGGCCCCAGGCTGCAGGCGG + Intronic
1180078012 21:45472981-45473003 GGGGAGCCCCAGGCTCCAGCTGG + Intronic
1181178889 22:21053695-21053717 GGGAAGGCCAAGGCTGCAGTGGG - Intronic
1182427120 22:30279750-30279772 GAAACTCCCCAGGCTCCTGTGGG + Intergenic
1185043088 22:48515697-48515719 GGGAGGCCCCCGGCTCCAGGCGG + Intronic
1185067520 22:48639599-48639621 GATCAGGCCCAGGCTCCAGGAGG - Intronic
1185134723 22:49063126-49063148 CAGAAGCCTCAGGCACCAGGAGG + Intergenic
1185247599 22:49781384-49781406 GAGAAGCCCCAGGGCCCACCTGG + Intronic
1185317943 22:50186687-50186709 GCGAAGCCCCAGGTTTCAGCGGG - Intronic
1203256810 22_KI270733v1_random:143227-143249 GAGAAGCCCAAGGCTACGGAAGG - Intergenic
950441888 3:13015299-13015321 GACCAGCCCCAGGCCCCATTAGG - Intronic
951891810 3:27574617-27574639 GAGAAGCCATAGGCCCCAGCTGG - Intergenic
954303568 3:49713969-49713991 GAGCCGCACCAGGATCCAGTTGG - Exonic
954363542 3:50134701-50134723 GAGAAGCCCCAGGCTAGGGCTGG + Intergenic
954883654 3:53853481-53853503 GAGAATCTACAGACTCCAGTTGG + Intronic
954955750 3:54517123-54517145 GAGAAGACGCAGGCTCAAGAAGG + Intronic
956406356 3:68932409-68932431 GAGAAGCCCGAAGCTCCTGCGGG + Exonic
958631130 3:96685391-96685413 GAGGTGCCCCAGGCTCCAGGTGG + Intergenic
960611536 3:119559273-119559295 GGGAAGCCACAGCCTCCTGTGGG + Intronic
961622997 3:128239448-128239470 GAGGAATCCCAGGCTCCAGGAGG + Intronic
961983389 3:131104820-131104842 GAGAGGCCCCCGGCTCCCCTGGG - Intronic
962989081 3:140562406-140562428 GTGAAGCCCCAGGGACCAGTTGG + Intronic
966843354 3:184106709-184106731 GAGAAGCTCCAGACTGAAGTTGG - Intronic
967057701 3:185844108-185844130 GGAAAGCCCCAGTCTGCAGTAGG - Intergenic
967296110 3:187966604-187966626 AAGAAGCCTCAGGCACCAATTGG + Intergenic
968730644 4:2267806-2267828 GAGACGCCTCAGCCTGCAGTGGG + Intergenic
968818616 4:2834231-2834253 GCTAAGACACAGGCTCCAGTAGG + Exonic
969600317 4:8172226-8172248 GAGAAGACGCAGACACCAGTGGG + Intergenic
971158505 4:24108747-24108769 GATGAACCCCAGGCTCCACTGGG - Intergenic
974697849 4:65398134-65398156 GAGAAGCCCCCTGCCCCTGTAGG + Intronic
974727017 4:65810897-65810919 AATAAGCCCCAGTCTCCGGTAGG - Intergenic
979519483 4:121650236-121650258 GGGAAACCCCAGGGTTCAGTAGG - Intergenic
980963402 4:139498512-139498534 GGGAAGCACCAGGATCAAGTAGG - Intronic
985553864 5:546649-546671 GCCAAGCCTCAGTCTCCAGTCGG - Intergenic
988938100 5:36110586-36110608 CAAAAGCCCCAGACTCAAGTAGG + Intronic
989710425 5:44389891-44389913 GCCAAGCACCAGGCTCCAGGTGG - Intergenic
992819825 5:80485236-80485258 AAGCAGCCCCAGACTCAAGTTGG + Intergenic
1002448292 5:179303293-179303315 GAGAAGGTTCAGGTTCCAGTAGG + Intronic
1003528171 6:6915701-6915723 GAGAAATCCCAGCCTCCAGAAGG + Intergenic
1004074052 6:12329201-12329223 GACAAAGCCCATGCTCCAGTGGG - Intergenic
1006984437 6:38167651-38167673 GAGGAGGCCAAGGCTCCAGGTGG + Intergenic
1010233879 6:73558973-73558995 GAGGAGCCCCATCCTCCAGGAGG + Intergenic
1014692503 6:124578624-124578646 GAGTTGCCCCTGGCCCCAGTAGG - Intronic
1018460805 6:163996725-163996747 GAGAAGGCACAGGCCCAAGTGGG - Intergenic
1019299239 7:295294-295316 AAGGAGCCTCAGACTCCAGTGGG - Intergenic
1019938437 7:4271192-4271214 GTGAAGCCCCAGGCCCCGCTAGG + Intergenic
1021677530 7:23096846-23096868 GTGAAGACACAGGCTGCAGTGGG + Intergenic
1022391828 7:29950303-29950325 GAGAAGCCCGAGGCGGCAGGGGG - Intronic
1022631470 7:32089344-32089366 GAGAGGCCCCAGGGTTCTGTAGG - Intronic
1022905018 7:34847460-34847482 GAGAATTCCCAAGCTGCAGTTGG + Intronic
1024516915 7:50267041-50267063 CAGAAACCACAGGCTCCTGTGGG + Intergenic
1027234001 7:76287154-76287176 CAGATGCCCCGGGCTCCAGTGGG + Exonic
1028264386 7:88705231-88705253 AAGGTGCCCCAGGCTCCAGCTGG + Intergenic
1029350831 7:100011777-100011799 GAGAAGCCACAGCTTCCAATAGG + Intergenic
1031479733 7:122264289-122264311 CACAAGCACCATGCTCCAGTTGG + Intergenic
1032391242 7:131556623-131556645 GAGTAGCCGCAGCCGCCAGTGGG - Intronic
1033507026 7:142013802-142013824 GAGAAGCCCCAGGTGCTTGTGGG - Intronic
1033875806 7:145817447-145817469 TGAAAGCCCCAGGCTCCACTGGG + Intergenic
1035634261 8:1131561-1131583 GTGAAGCCCTAACCTCCAGTGGG - Intergenic
1035922880 8:3696979-3697001 TAGGGGCCCCAGGATCCAGTAGG + Intronic
1036386348 8:8285125-8285147 GAAAAACACCAGGCTCCAGCGGG - Intergenic
1037016259 8:13910714-13910736 GAGTAGCCCCAAGCACCAGCAGG - Intergenic
1038779411 8:30557456-30557478 GAGAATCCCCAGACTTCAGCTGG + Intronic
1039419452 8:37423828-37423850 GAGGAGCCCCAGGCCCCAAAGGG + Intergenic
1040277590 8:46021879-46021901 GAGAAGAACCAGGCATCAGTGGG + Intergenic
1042709257 8:71697043-71697065 AATAAGCCCCAGTCTCCTGTAGG - Intergenic
1042871827 8:73406707-73406729 GAGAGGTCCCAGCCTCCAGGAGG + Intergenic
1043756139 8:84005920-84005942 GGGAAGCCCCCGGCCCCCGTAGG - Intergenic
1047496547 8:125412928-125412950 GAGGAACCCCAGGCTCCAGGAGG - Intergenic
1048348873 8:133599714-133599736 GAGAAGGCTGAGGCTCCAGGAGG - Intergenic
1048641640 8:136369937-136369959 CAGTAGCTCCAGGCACCAGTGGG + Intergenic
1049261943 8:141644053-141644075 AAGAAGCTCCAGGCTCCTCTTGG + Intergenic
1049560240 8:143306707-143306729 GAGCAGGCCCAGACTCCAGAAGG - Intronic
1049941596 9:551170-551192 GAAAAGCCCCAGGCAACAGAGGG - Intronic
1051910948 9:22154183-22154205 GAGAACCCCCAGGGTACAGGAGG + Intergenic
1053146494 9:35715554-35715576 GAAAAGCCCCAGAGTCCAGGGGG + Intronic
1053237377 9:36468166-36468188 CAGAAGCTCAAGGCTGCAGTGGG + Intronic
1055237005 9:74134038-74134060 GAGAAGCCCCACCCTCAAGCCGG - Intergenic
1057215194 9:93224060-93224082 GAGAAGCTCCAGGCTTCCTTTGG + Intronic
1057546612 9:96023615-96023637 GAGAAACTCCGGGCTCCATTCGG - Intergenic
1057854635 9:98593265-98593287 GAGAAGCCCCAGGGTTTAATGGG - Intronic
1058697981 9:107575996-107576018 GAGGAGCACCTTGCTCCAGTGGG + Intergenic
1060199712 9:121645390-121645412 GGGAAGCCCAGGGCTCCTGTGGG + Intronic
1060422971 9:123482807-123482829 CAGAAGCCCCAGGCCTCTGTGGG + Intronic
1060967166 9:127717766-127717788 GGGAGGCCCCAGGCACCTGTAGG - Exonic
1061313152 9:129777162-129777184 GGTGAACCCCAGGCTCCAGTTGG - Intergenic
1061789452 9:133051440-133051462 GGGAAGCGCCGGGCTCCAGGTGG - Intronic
1062080331 9:134620260-134620282 GAGAGGCCCCATGCCCCTGTAGG + Intergenic
1062157357 9:135060521-135060543 GAGGACACCCAGGCTTCAGTTGG - Intergenic
1062208151 9:135348557-135348579 GAGAAGCCCCTCGCTCCTCTCGG + Intergenic
1062424531 9:136499990-136500012 GCGAGTCCCCAGGCTCCAGGCGG - Intronic
1062545921 9:137063728-137063750 GAGAACCCCCAGGGTACAGGAGG - Exonic
1062572757 9:137193150-137193172 GAGAGGCCCCAGACACCAGCAGG - Intronic
1203472967 Un_GL000220v1:124909-124931 GAGAAGCCCAAGGCTACGGAAGG - Intergenic
1189529586 X:41865916-41865938 AAGGAGACCCAGGCCCCAGTAGG - Intronic
1190927538 X:54922591-54922613 GGGAAGCCCCAGGCTCCCCGGGG - Exonic
1192148833 X:68699310-68699332 GGGAAGCCCCAAGCTTCAGAAGG - Intronic
1192273298 X:69604822-69604844 GAGAAGCCCCAGCCTCCAAAGGG - Intergenic
1193876515 X:86868802-86868824 GAGATACCCCAGGTTCCAGGTGG + Intergenic
1193962203 X:87939898-87939920 CCGCAGCCCCAGGCTCCAGCGGG + Intergenic
1194591589 X:95805922-95805944 GAGATCCCCCAGGCCCCAGGTGG - Intergenic
1198173331 X:134129567-134129589 CAGCAGCCCCAGGCTATAGTGGG + Intergenic
1200143956 X:153916375-153916397 GAGAGGCCCCAGGCTCCCCACGG + Intronic