ID: 907541090

View in Genome Browser
Species Human (GRCh38)
Location 1:55215695-55215717
Sequence AAGCCGGGTCGCGGCTGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907541090_907541101 19 Left 907541090 1:55215695-55215717 CCTCCGCAGCCGCGACCCGGCTT No data
Right 907541101 1:55215737-55215759 GAGCCTCTCCGAACCCCCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907541090 Original CRISPR AAGCCGGGTCGCGGCTGCGG AGG (reversed) Intergenic