ID: 907542768

View in Genome Browser
Species Human (GRCh38)
Location 1:55231285-55231307
Sequence GAGAGGAGGGTTCAGTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907542762_907542768 17 Left 907542762 1:55231245-55231267 CCTATGAAGGTTTTCTGCTGGTT No data
Right 907542768 1:55231285-55231307 GAGAGGAGGGTTCAGTTTATGGG No data
907542761_907542768 18 Left 907542761 1:55231244-55231266 CCCTATGAAGGTTTTCTGCTGGT No data
Right 907542768 1:55231285-55231307 GAGAGGAGGGTTCAGTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907542768 Original CRISPR GAGAGGAGGGTTCAGTTTAT GGG Intergenic
No off target data available for this crispr