ID: 907544732

View in Genome Browser
Species Human (GRCh38)
Location 1:55249857-55249879
Sequence GTAAGGCTGCACCACAGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907544726_907544732 3 Left 907544726 1:55249831-55249853 CCACATGCACCATCTGTGCTTCT No data
Right 907544732 1:55249857-55249879 GTAAGGCTGCACCACAGCGGGGG No data
907544727_907544732 -6 Left 907544727 1:55249840-55249862 CCATCTGTGCTTCTTCTGTAAGG No data
Right 907544732 1:55249857-55249879 GTAAGGCTGCACCACAGCGGGGG No data
907544725_907544732 9 Left 907544725 1:55249825-55249847 CCAAGTCCACATGCACCATCTGT No data
Right 907544732 1:55249857-55249879 GTAAGGCTGCACCACAGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907544732 Original CRISPR GTAAGGCTGCACCACAGCGG GGG Intergenic