ID: 907545718

View in Genome Browser
Species Human (GRCh38)
Location 1:55258360-55258382
Sequence AGTTTGCTGCTGAAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907545710_907545718 29 Left 907545710 1:55258308-55258330 CCCTTCCACCAAGTTCTACAAAA No data
Right 907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG No data
907545716_907545718 -4 Left 907545716 1:55258341-55258363 CCAATTCTTTTGTGAGCTTAGTT No data
Right 907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG No data
907545712_907545718 24 Left 907545712 1:55258313-55258335 CCACCAAGTTCTACAAAACCCAC No data
Right 907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG No data
907545715_907545718 5 Left 907545715 1:55258332-55258354 CCACATGCACCAATTCTTTTGTG No data
Right 907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG No data
907545714_907545718 6 Left 907545714 1:55258331-55258353 CCCACATGCACCAATTCTTTTGT No data
Right 907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG No data
907545711_907545718 28 Left 907545711 1:55258309-55258331 CCTTCCACCAAGTTCTACAAAAC No data
Right 907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG No data
907545713_907545718 21 Left 907545713 1:55258316-55258338 CCAAGTTCTACAAAACCCACATG No data
Right 907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907545718 Original CRISPR AGTTTGCTGCTGAAGATGGC TGG Intergenic
No off target data available for this crispr