ID: 907550605

View in Genome Browser
Species Human (GRCh38)
Location 1:55301593-55301615
Sequence GAATCATTTACAACAATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907550605_907550607 18 Left 907550605 1:55301593-55301615 CCAGGCATTGTTGTAAATGATTC No data
Right 907550607 1:55301634-55301656 GATCAAAAGCCCTAGCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907550605 Original CRISPR GAATCATTTACAACAATGCC TGG (reversed) Intergenic
No off target data available for this crispr