ID: 907550607

View in Genome Browser
Species Human (GRCh38)
Location 1:55301634-55301656
Sequence GATCAAAAGCCCTAGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907550605_907550607 18 Left 907550605 1:55301593-55301615 CCAGGCATTGTTGTAAATGATTC No data
Right 907550607 1:55301634-55301656 GATCAAAAGCCCTAGCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907550607 Original CRISPR GATCAAAAGCCCTAGCAGAA TGG Intergenic