ID: 907552338

View in Genome Browser
Species Human (GRCh38)
Location 1:55314912-55314934
Sequence ATGCTGGTTTTGATGACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907552338_907552344 -10 Left 907552338 1:55314912-55314934 CCTTATGTCATCAAAACCAGCAT No data
Right 907552344 1:55314925-55314947 AAACCAGCATGGGGAGGGCATGG No data
907552338_907552347 -5 Left 907552338 1:55314912-55314934 CCTTATGTCATCAAAACCAGCAT No data
Right 907552347 1:55314930-55314952 AGCATGGGGAGGGCATGGCTGGG No data
907552338_907552349 10 Left 907552338 1:55314912-55314934 CCTTATGTCATCAAAACCAGCAT No data
Right 907552349 1:55314945-55314967 TGGCTGGGTGTTGTTGGTGATGG No data
907552338_907552346 -6 Left 907552338 1:55314912-55314934 CCTTATGTCATCAAAACCAGCAT No data
Right 907552346 1:55314929-55314951 CAGCATGGGGAGGGCATGGCTGG No data
907552338_907552350 22 Left 907552338 1:55314912-55314934 CCTTATGTCATCAAAACCAGCAT No data
Right 907552350 1:55314957-55314979 GTTGGTGATGGCTCAAGCACAGG No data
907552338_907552348 4 Left 907552338 1:55314912-55314934 CCTTATGTCATCAAAACCAGCAT No data
Right 907552348 1:55314939-55314961 AGGGCATGGCTGGGTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907552338 Original CRISPR ATGCTGGTTTTGATGACATA AGG (reversed) Intergenic
No off target data available for this crispr