ID: 907552747

View in Genome Browser
Species Human (GRCh38)
Location 1:55318243-55318265
Sequence CGCCTTCAGACTTGCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907552740_907552747 14 Left 907552740 1:55318206-55318228 CCTTCCTGCAAGGCCGACTCTGC No data
Right 907552747 1:55318243-55318265 CGCCTTCAGACTTGCAGTCCTGG No data
907552741_907552747 10 Left 907552741 1:55318210-55318232 CCTGCAAGGCCGACTCTGCTGAT No data
Right 907552747 1:55318243-55318265 CGCCTTCAGACTTGCAGTCCTGG No data
907552744_907552747 1 Left 907552744 1:55318219-55318241 CCGACTCTGCTGATACCCTGGGT No data
Right 907552747 1:55318243-55318265 CGCCTTCAGACTTGCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907552747 Original CRISPR CGCCTTCAGACTTGCAGTCC TGG Intergenic
No off target data available for this crispr