ID: 907556542

View in Genome Browser
Species Human (GRCh38)
Location 1:55349127-55349149
Sequence GTGGGGCCTGACTCTTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907556542_907556543 -9 Left 907556542 1:55349127-55349149 CCAACAGAAGAGTCAGGCCCCAC 0: 1
1: 0
2: 1
3: 7
4: 142
Right 907556543 1:55349141-55349163 AGGCCCCACACCTCTAAGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907556542 Original CRISPR GTGGGGCCTGACTCTTCTGT TGG (reversed) Intergenic
900486526 1:2925268-2925290 GGGGTGCCTGGCTGTTCTGTGGG + Intergenic
900537753 1:3187242-3187264 GTGGGCCCTGGCCCTTCTGCCGG + Intronic
904434307 1:30484325-30484347 GTGGGGCCTTTCTGTCCTGTAGG - Intergenic
904713854 1:32451915-32451937 GTTGGTCTTGACTCTTTTGTTGG + Intergenic
907556542 1:55349127-55349149 GTGGGGCCTGACTCTTCTGTTGG - Intergenic
912841342 1:113042153-113042175 ATCTGGCCTGACTCTTCTGGGGG + Intergenic
913085259 1:115430936-115430958 GTGCTGCCTTACTCATCTGTCGG - Intergenic
914248105 1:145900799-145900821 ATGGGGCCTGACTCCACTCTGGG + Exonic
917056681 1:170989993-170990015 GGGGGGCCTTACTCGTCTGCTGG - Exonic
917592845 1:176495009-176495031 TTGGGGCCTGACTTTAGTGTAGG - Intronic
918563534 1:185898239-185898261 GTGGGGAGTGACTCTTCTCCTGG + Intronic
921462964 1:215450487-215450509 GTGGTTCCTGACTGTTCTCTGGG + Intergenic
922192972 1:223335773-223335795 GTTGGGACTGACTCTTCGCTAGG - Intronic
923252355 1:232189294-232189316 GTGAGTGCTGACTCTGCTGTGGG - Intergenic
1071475358 10:86020731-86020753 GTGGGGCCTGCCTGTCCTGTGGG - Intronic
1076626107 10:131822950-131822972 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626129 10:131823035-131823057 CTGGGGCCTGCATCTCCTGTGGG - Intergenic
1076626152 10:131823121-131823143 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626176 10:131823207-131823229 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626189 10:131823250-131823272 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626203 10:131823294-131823316 CTGGGGCCTGCATCTCCTGTGGG - Intergenic
1076626217 10:131823338-131823360 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626229 10:131823380-131823402 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626262 10:131823508-131823530 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626275 10:131823551-131823573 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626308 10:131823679-131823701 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626331 10:131823764-131823786 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626376 10:131823932-131823954 CTGGGGCCTGCATCTCCTGTGGG - Intergenic
1076626399 10:131824017-131824039 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626422 10:131824102-131824124 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626456 10:131824230-131824252 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076626476 10:131824315-131824337 CTGGGGCCTGCGTCTCCTGTGGG - Intergenic
1076733738 10:132450044-132450066 TTGGGGCCTGCCTCCTCTGCTGG + Intergenic
1077116989 11:889671-889693 GTGGGGCCTGGCTCTGCAGGTGG - Intronic
1083170229 11:60919822-60919844 CTGGGGCTTCTCTCTTCTGTTGG - Exonic
1083668800 11:64289210-64289232 CTGGGGCCTGGGTATTCTGTGGG - Exonic
1086495515 11:87400752-87400774 GTGGGGCGTTTCTCTTCTCTGGG + Intergenic
1087479456 11:98680833-98680855 CTGGGGCATGTCTGTTCTGTAGG - Intergenic
1088408385 11:109505978-109506000 GTGGGCCCTCACCCTTCTATAGG - Intergenic
1089253569 11:117181731-117181753 GTGGGGCCTCGCTCCTCTGGAGG + Intronic
1089297870 11:117480790-117480812 GAGAGGGCTGACTCTTCTGCAGG + Intronic
1089329588 11:117680317-117680339 GTGGCCCCTGACCCTCCTGTGGG + Intronic
1091765466 12:3117451-3117473 CTAGGGCCTGTCTCTTCCGTTGG + Intronic
1098548418 12:71736697-71736719 CTAAGGCCTGACTCTTCTGAGGG + Intergenic
1101833509 12:108278183-108278205 GTGTCTCCTGTCTCTTCTGTAGG + Intergenic
1103693572 12:122795799-122795821 GTGGGTCCTGACAGTCCTGTAGG + Intronic
1107835719 13:44411051-44411073 GTGGGCCCTGTGTCTTCTATAGG - Intergenic
1109654047 13:65366491-65366513 CAGGGGTGTGACTCTTCTGTTGG - Intergenic
1111915127 13:94352473-94352495 TTGGGGCCTCACTCTCCTCTAGG - Intronic
1113706105 13:112433930-112433952 CTGGGACCTGACTGTTCTGCAGG + Intronic
1119773130 14:77233908-77233930 GTGGGGCACGAGTCTGCTGTGGG - Intronic
1119949041 14:78725684-78725706 GTGGGGGGTGACTCTTTTATCGG + Intronic
1121611988 14:95287544-95287566 GTGGGGCCTGGTGCTTCTGATGG - Intronic
1122046192 14:99025699-99025721 GGGGGGCCGGACTCTTGTGGGGG - Intergenic
1122759851 14:104015316-104015338 GTGGAGACTGCCTCTGCTGTAGG + Intronic
1123117689 14:105902054-105902076 GTGGGGCCGGATCCTCCTGTAGG + Intergenic
1125671454 15:41476313-41476335 CTGGGGCATGACACTGCTGTAGG + Intronic
1126100441 15:45115405-45115427 CTGGGGCCTCCCTCTTCTGAGGG + Intronic
1127787711 15:62371016-62371038 CTGGGGCCTCACTCCTCTATAGG - Intergenic
1129455854 15:75675917-75675939 ATGGGGCCTGGCTCGCCTGTGGG + Exonic
1136051593 16:27654525-27654547 CTGGGGCCTCGCTCTTCTGTTGG - Intronic
1139278447 16:65749501-65749523 GTGGGGACTGGCTCTTCTCAGGG - Intergenic
1139530926 16:67542398-67542420 GTGGGGCCTGGCAGTTCTGAAGG - Exonic
1139654550 16:68379426-68379448 GTGGTGCCTGCCTCATCTCTAGG + Intronic
1140459811 16:75130696-75130718 GGGTGGCCTGACTTTCCTGTTGG + Intergenic
1141397769 16:83719917-83719939 GTGGGGTCAGACTCCACTGTAGG + Intronic
1142197611 16:88745990-88746012 GCTGGGCCTGATTGTTCTGTGGG + Intronic
1142351788 16:89583969-89583991 GTGGGGCCTGACCCCACCGTGGG - Intronic
1142871903 17:2826609-2826631 GTGGGGCCTGAATGTCCTCTTGG + Intronic
1151786277 17:76276596-76276618 GTGGGGCCTGGCACTTTTATGGG - Intronic
1152562584 17:81085984-81086006 CTGGTGCCTGACTCTGCTGCCGG + Intronic
1155450595 18:25959079-25959101 CTGGGGCTGGAGTCTTCTGTAGG + Intergenic
1158963635 18:62605891-62605913 GTGGGGCCAGACTCATCAGCAGG + Intergenic
1160476568 18:79195084-79195106 GTGTGGGCTGACTCTTCTGATGG - Intronic
1160940316 19:1617770-1617792 GTGGGTCCGGACCCTTCTCTGGG + Intronic
1161724256 19:5919232-5919254 GAGGGCCCTGACTCTTCTAGAGG + Intronic
1163393365 19:17044100-17044122 GTGGGGTCTGTCTGTTCAGTGGG + Intergenic
1164682621 19:30145754-30145776 TTGGCGCCGGACTTTTCTGTGGG + Intergenic
1165130712 19:33630058-33630080 TTGGGGGCTGACTCATCTCTTGG + Intronic
1168251633 19:55145550-55145572 TTGGGGCGTTCCTCTTCTGTTGG + Exonic
1168349138 19:55666087-55666109 GAGGAGCTTGACTCTTCTGAAGG + Intronic
925104369 2:1277874-1277896 GTGGGGCCGGACACTTCCGGTGG - Intronic
929054019 2:37860580-37860602 GTGGGGCCAGCATCTACTGTGGG + Intergenic
931669167 2:64631152-64631174 CTGGGGGCTGATTCTTCTGTGGG - Intergenic
933191166 2:79335696-79335718 GTGGGGCTTCTCTCATCTGTTGG + Intronic
936461972 2:112720976-112720998 GTGGTGCCTGAAGCTTCTGAGGG + Intergenic
938062073 2:128262037-128262059 GTGGGCCCAGCCTCTCCTGTGGG - Intronic
938639658 2:133266078-133266100 GTGGGGCCTCGCTTTTGTGTGGG - Intronic
940237741 2:151529080-151529102 CTGGGGCCTGACTCTTGCTTTGG + Intronic
940651789 2:156447963-156447985 ATGGGTCCTGACTCAACTGTGGG - Intronic
946473411 2:219984085-219984107 GTGGGGAGTGAGTCTTTTGTGGG + Intergenic
948171165 2:235904449-235904471 GGGGGGCCTGGCTCTTGAGTGGG + Intronic
1170098074 20:12668979-12669001 GTTTGCCCTGGCTCTTCTGTGGG + Intergenic
1175457224 20:59124569-59124591 GTGGGGCCAGACGCCTCCGTGGG + Intergenic
1176152844 20:63601784-63601806 GTGGGGCCTGTGGCTTCTGTGGG + Intronic
1176152857 20:63601838-63601860 GTGGGGCCTGTGGCTTCCGTGGG + Intronic
1176152872 20:63601892-63601914 GTGGGGCCTGTGGCTTCCGTGGG + Intronic
1180999851 22:19983008-19983030 GTTGGGCCTGGCTCTGATGTGGG - Intronic
1182143570 22:27982985-27983007 GTGATGGCTGACTCTTCTGATGG + Exonic
1182437253 22:30338677-30338699 GTGGGGCCTGAGTGTTGGGTGGG - Intronic
1185317946 22:50186698-50186720 CTGGGGCTTCGCTCTTCTGTAGG + Intronic
950300393 3:11872342-11872364 GAGGGGCGTGCATCTTCTGTAGG + Intergenic
951620358 3:24594723-24594745 CTGGGGCCTGATTCATCTCTTGG - Intergenic
954616432 3:51970990-51971012 GTGAGACCTGAGTCTTCTGGGGG - Intronic
954718118 3:52537053-52537075 GGGCGGCCTGGCTCTCCTGTAGG + Intronic
959800012 3:110482148-110482170 GGGAAGGCTGACTCTTCTGTGGG + Intergenic
961088443 3:124090085-124090107 GAGGGGACTGGCTCTTGTGTGGG + Intronic
963274053 3:143313195-143313217 GTAGAGCCTGAGTCTGCTGTGGG + Intronic
965517758 3:169640253-169640275 GTTGGGCCTGATTATTCTTTAGG - Intronic
966602004 3:181785181-181785203 GTGTGGCCTGACTCAGCTGTGGG + Intergenic
968071817 3:195788905-195788927 GTTGGGCTTGACTGTCCTGTCGG + Exonic
968905689 4:3449627-3449649 GTGGGGCCAGACCCCGCTGTGGG - Intergenic
969309656 4:6346039-6346061 GTGGGGCGTGACTCTGTGGTTGG - Intronic
974789201 4:66664096-66664118 GTGAGGGCTGAATCTTCTGAAGG + Intergenic
980064075 4:128163889-128163911 GTGGGGGCTCAACCTTCTGTGGG - Intronic
980207212 4:129735260-129735282 GTGGTTCCTGAATCTGCTGTAGG + Intergenic
985674870 5:1225773-1225795 GAGGGGACTGACTCTGCCGTGGG - Intronic
986392523 5:7299733-7299755 GTGGCGGCTTACACTTCTGTAGG + Intergenic
987359622 5:17095141-17095163 GTGCGGCCTCGCCCTTCTGTTGG - Intronic
992087443 5:73290535-73290557 GTGGGCCCTGCTCCTTCTGTAGG + Intergenic
992555030 5:77894629-77894651 GAGGGAGCTGACTTTTCTGTAGG - Intergenic
994305658 5:98201076-98201098 GAGGGGCCTGACACCTGTGTAGG + Intergenic
997240121 5:132300848-132300870 GTTGGGACTGAAGCTTCTGTTGG + Intronic
999276272 5:150332598-150332620 GTGGGGCATGTCCCTTCAGTAGG + Intronic
1000060703 5:157652535-157652557 GTGCGGCCTGAGTAATCTGTCGG + Intronic
1000065702 5:157691350-157691372 GTGCGGCCTGAGTAATCTGTCGG + Intergenic
1006944660 6:37777481-37777503 CTGGGGCCTGACTCCTCCCTGGG - Intergenic
1015298100 6:131622127-131622149 TTGGAACATGACTCTTCTGTTGG - Intronic
1017019984 6:150132405-150132427 GCTGGGCCTGAGGCTTCTGTGGG + Intergenic
1019417952 7:935778-935800 GTGGGGCCGGCCTCTGCTGGAGG - Intronic
1028906790 7:96163398-96163420 CTGGGGCCAGACTCATCTGAAGG - Intronic
1030297597 7:107944521-107944543 GTTGGGCCTGACTCTCCGGGAGG + Intronic
1031909989 7:127505880-127505902 CTGGGGCTTGACTCTGATGTTGG - Intergenic
1035253062 7:157609853-157609875 GTGGGATGTGTCTCTTCTGTTGG - Intronic
1038778004 8:30548403-30548425 GTGGGGCCAGAAGCTTCTGTAGG + Intronic
1039859861 8:41447794-41447816 GTGGGGTTTGACTCTTCTTCTGG - Intergenic
1047757834 8:127932127-127932149 GTGGGGCCTGCCTCTTTGCTGGG + Intergenic
1048338799 8:133523190-133523212 GTGGGTCCTAACTCTTCTGTGGG + Intronic
1051550830 9:18327358-18327380 ATAGGGCCTGACTCTACTCTGGG - Intergenic
1053290819 9:36878689-36878711 GTGGGCCCTCTCTGTTCTGTGGG + Intronic
1055697563 9:78903194-78903216 GTGTTGCCTGACCCTCCTGTAGG + Intergenic
1056237336 9:84607938-84607960 GTGGCTCATGACTCTACTGTGGG + Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057929842 9:99184078-99184100 GAGGGGCCTGAATCTCTTGTTGG + Intergenic
1060157717 9:121331568-121331590 GTGGGGACTTCCTCCTCTGTGGG + Intronic
1062338525 9:136083177-136083199 GTGGCCACTGGCTCTTCTGTTGG - Intronic
1185469117 X:372025-372047 TGGGGCCCTGGCTCTTCTGTGGG - Intronic
1185803354 X:3033324-3033346 GTGGGACCTTCCCCTTCTGTGGG + Exonic
1189217944 X:39343484-39343506 GTTGGGACTTTCTCTTCTGTAGG - Intergenic
1199571784 X:149273800-149273822 GTGCTGCCTCACTCTCCTGTTGG + Intergenic
1200425192 Y:3012785-3012807 CTGGGCCCTGAGTCTTCTCTGGG + Intergenic