ID: 907558993

View in Genome Browser
Species Human (GRCh38)
Location 1:55371199-55371221
Sequence TCTGAGGCCATGAAGCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907558988_907558993 13 Left 907558988 1:55371163-55371185 CCTCAGGTCAGAGCACCTCTGAA No data
Right 907558993 1:55371199-55371221 TCTGAGGCCATGAAGCATGAGGG No data
907558990_907558993 -2 Left 907558990 1:55371178-55371200 CCTCTGAATCAAGGATTCAGCTC No data
Right 907558993 1:55371199-55371221 TCTGAGGCCATGAAGCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907558993 Original CRISPR TCTGAGGCCATGAAGCATGA GGG Intergenic
No off target data available for this crispr