ID: 907566739

View in Genome Browser
Species Human (GRCh38)
Location 1:55442584-55442606
Sequence GCATCCATCTGAAGAGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907566739_907566743 27 Left 907566739 1:55442584-55442606 CCCAAACCTCTTCAGATGGATGC No data
Right 907566743 1:55442634-55442656 CTTCAAGCAGGTTACAATCAAGG No data
907566739_907566742 15 Left 907566739 1:55442584-55442606 CCCAAACCTCTTCAGATGGATGC No data
Right 907566742 1:55442622-55442644 AAATATTAGTATCTTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907566739 Original CRISPR GCATCCATCTGAAGAGGTTT GGG (reversed) Intergenic