ID: 907566742

View in Genome Browser
Species Human (GRCh38)
Location 1:55442622-55442644
Sequence AAATATTAGTATCTTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907566736_907566742 24 Left 907566736 1:55442575-55442597 CCTACCTGACCCAAACCTCTTCA No data
Right 907566742 1:55442622-55442644 AAATATTAGTATCTTCAAGCAGG No data
907566740_907566742 14 Left 907566740 1:55442585-55442607 CCAAACCTCTTCAGATGGATGCA No data
Right 907566742 1:55442622-55442644 AAATATTAGTATCTTCAAGCAGG No data
907566737_907566742 20 Left 907566737 1:55442579-55442601 CCTGACCCAAACCTCTTCAGATG No data
Right 907566742 1:55442622-55442644 AAATATTAGTATCTTCAAGCAGG No data
907566741_907566742 9 Left 907566741 1:55442590-55442612 CCTCTTCAGATGGATGCAGTTTT No data
Right 907566742 1:55442622-55442644 AAATATTAGTATCTTCAAGCAGG No data
907566739_907566742 15 Left 907566739 1:55442584-55442606 CCCAAACCTCTTCAGATGGATGC No data
Right 907566742 1:55442622-55442644 AAATATTAGTATCTTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907566742 Original CRISPR AAATATTAGTATCTTCAAGC AGG Intergenic