ID: 907566743

View in Genome Browser
Species Human (GRCh38)
Location 1:55442634-55442656
Sequence CTTCAAGCAGGTTACAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907566739_907566743 27 Left 907566739 1:55442584-55442606 CCCAAACCTCTTCAGATGGATGC No data
Right 907566743 1:55442634-55442656 CTTCAAGCAGGTTACAATCAAGG No data
907566740_907566743 26 Left 907566740 1:55442585-55442607 CCAAACCTCTTCAGATGGATGCA No data
Right 907566743 1:55442634-55442656 CTTCAAGCAGGTTACAATCAAGG No data
907566741_907566743 21 Left 907566741 1:55442590-55442612 CCTCTTCAGATGGATGCAGTTTT No data
Right 907566743 1:55442634-55442656 CTTCAAGCAGGTTACAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907566743 Original CRISPR CTTCAAGCAGGTTACAATCA AGG Intergenic