ID: 907569133

View in Genome Browser
Species Human (GRCh38)
Location 1:55466916-55466938
Sequence CGTAGCATCTTCATCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907569133_907569137 22 Left 907569133 1:55466916-55466938 CCCTGGCAGATGAAGATGCTACG No data
Right 907569137 1:55466961-55466983 ATTAAGGCATCATGAGTCAAAGG No data
907569133_907569136 6 Left 907569133 1:55466916-55466938 CCCTGGCAGATGAAGATGCTACG No data
Right 907569136 1:55466945-55466967 GAGGAATCAACTCATCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907569133 Original CRISPR CGTAGCATCTTCATCTGCCA GGG (reversed) Intergenic
No off target data available for this crispr