ID: 907569136

View in Genome Browser
Species Human (GRCh38)
Location 1:55466945-55466967
Sequence GAGGAATCAACTCATCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907569133_907569136 6 Left 907569133 1:55466916-55466938 CCCTGGCAGATGAAGATGCTACG No data
Right 907569136 1:55466945-55466967 GAGGAATCAACTCATCATTAAGG No data
907569134_907569136 5 Left 907569134 1:55466917-55466939 CCTGGCAGATGAAGATGCTACGA No data
Right 907569136 1:55466945-55466967 GAGGAATCAACTCATCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907569136 Original CRISPR GAGGAATCAACTCATCATTA AGG Intergenic
No off target data available for this crispr