ID: 907569558

View in Genome Browser
Species Human (GRCh38)
Location 1:55470357-55470379
Sequence GAGCACTCCAGGATCTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907569555_907569558 -4 Left 907569555 1:55470338-55470360 CCAAGAGTTTCTTTCTGGTGAGC No data
Right 907569558 1:55470357-55470379 GAGCACTCCAGGATCTCCTTGGG No data
907569553_907569558 11 Left 907569553 1:55470323-55470345 CCTGCTGCTGTGGAACCAAGAGT No data
Right 907569558 1:55470357-55470379 GAGCACTCCAGGATCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907569558 Original CRISPR GAGCACTCCAGGATCTCCTT GGG Intergenic
No off target data available for this crispr