ID: 907569558 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:55470357-55470379 |
Sequence | GAGCACTCCAGGATCTCCTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
907569555_907569558 | -4 | Left | 907569555 | 1:55470338-55470360 | CCAAGAGTTTCTTTCTGGTGAGC | No data | ||
Right | 907569558 | 1:55470357-55470379 | GAGCACTCCAGGATCTCCTTGGG | No data | ||||
907569553_907569558 | 11 | Left | 907569553 | 1:55470323-55470345 | CCTGCTGCTGTGGAACCAAGAGT | No data | ||
Right | 907569558 | 1:55470357-55470379 | GAGCACTCCAGGATCTCCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
907569558 | Original CRISPR | GAGCACTCCAGGATCTCCTT GGG | Intergenic | ||
No off target data available for this crispr |