ID: 907578753

View in Genome Browser
Species Human (GRCh38)
Location 1:55552927-55552949
Sequence AAGGGTAGGAAACTTATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907578747_907578753 20 Left 907578747 1:55552884-55552906 CCTTGTAGTGCTGCATCGTAATG No data
Right 907578753 1:55552927-55552949 AAGGGTAGGAAACTTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907578753 Original CRISPR AAGGGTAGGAAACTTATTTC AGG Intergenic
No off target data available for this crispr