ID: 907581239

View in Genome Browser
Species Human (GRCh38)
Location 1:55574603-55574625
Sequence CAACCTCGGAGGGAATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907581226_907581239 10 Left 907581226 1:55574570-55574592 CCAGAAAATAGTAAGACATGTCC No data
Right 907581239 1:55574603-55574625 CAACCTCGGAGGGAATGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907581239 Original CRISPR CAACCTCGGAGGGAATGGAG GGG Intergenic
No off target data available for this crispr