ID: 907581738

View in Genome Browser
Species Human (GRCh38)
Location 1:55578333-55578355
Sequence AGCTTTCCCCAGCACTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907581738_907581741 23 Left 907581738 1:55578333-55578355 CCTTGGAAGTGCTGGGGAAAGCT No data
Right 907581741 1:55578379-55578401 CACCTCCTAAGTCAATTGCATGG No data
907581738_907581744 30 Left 907581738 1:55578333-55578355 CCTTGGAAGTGCTGGGGAAAGCT No data
Right 907581744 1:55578386-55578408 TAAGTCAATTGCATGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907581738 Original CRISPR AGCTTTCCCCAGCACTTCCA AGG (reversed) Intergenic
No off target data available for this crispr