ID: 907583568

View in Genome Browser
Species Human (GRCh38)
Location 1:55593927-55593949
Sequence CCTAATTTGAAGGAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907583568_907583573 0 Left 907583568 1:55593927-55593949 CCTTCCATCTCCTTCAAATTAGG No data
Right 907583573 1:55593950-55593972 CAAGGCTATGTGATTTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907583568 Original CRISPR CCTAATTTGAAGGAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr