ID: 907583573

View in Genome Browser
Species Human (GRCh38)
Location 1:55593950-55593972
Sequence CAAGGCTATGTGATTTGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907583566_907583573 28 Left 907583566 1:55593899-55593921 CCTCCTTCTAGGAGCATGGAGTG No data
Right 907583573 1:55593950-55593972 CAAGGCTATGTGATTTGATTTGG No data
907583570_907583573 -4 Left 907583570 1:55593931-55593953 CCATCTCCTTCAAATTAGGCAAG No data
Right 907583573 1:55593950-55593972 CAAGGCTATGTGATTTGATTTGG No data
907583572_907583573 -10 Left 907583572 1:55593937-55593959 CCTTCAAATTAGGCAAGGCTATG No data
Right 907583573 1:55593950-55593972 CAAGGCTATGTGATTTGATTTGG No data
907583567_907583573 25 Left 907583567 1:55593902-55593924 CCTTCTAGGAGCATGGAGTGATT No data
Right 907583573 1:55593950-55593972 CAAGGCTATGTGATTTGATTTGG No data
907583568_907583573 0 Left 907583568 1:55593927-55593949 CCTTCCATCTCCTTCAAATTAGG No data
Right 907583573 1:55593950-55593972 CAAGGCTATGTGATTTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907583573 Original CRISPR CAAGGCTATGTGATTTGATT TGG Intergenic
No off target data available for this crispr