ID: 907584912

View in Genome Browser
Species Human (GRCh38)
Location 1:55608481-55608503
Sequence GCTCCAGGCTTGGCTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907584912_907584919 -8 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584919 1:55608496-55608518 CCTGGAGCGGCTGGGATGCAGGG No data
907584912_907584927 23 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584927 1:55608527-55608549 CCCAGGGCTGCACATAGGAGGGG No data
907584912_907584921 7 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584921 1:55608511-55608533 ATGCAGGGCACCAAATCCCAGGG No data
907584912_907584923 18 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584923 1:55608522-55608544 CAAATCCCAGGGCTGCACATAGG No data
907584912_907584925 22 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584925 1:55608526-55608548 TCCCAGGGCTGCACATAGGAGGG No data
907584912_907584924 21 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584924 1:55608525-55608547 ATCCCAGGGCTGCACATAGGAGG No data
907584912_907584929 24 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584929 1:55608528-55608550 CCAGGGCTGCACATAGGAGGGGG No data
907584912_907584917 -9 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584917 1:55608495-55608517 GCCTGGAGCGGCTGGGATGCAGG No data
907584912_907584930 25 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584930 1:55608529-55608551 CAGGGCTGCACATAGGAGGGGGG No data
907584912_907584920 6 Left 907584912 1:55608481-55608503 CCTCTTTTAGCCAAGCCTGGAGC No data
Right 907584920 1:55608510-55608532 GATGCAGGGCACCAAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907584912 Original CRISPR GCTCCAGGCTTGGCTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr