ID: 907585860

View in Genome Browser
Species Human (GRCh38)
Location 1:55617289-55617311
Sequence GGGACTTGGCCAATATGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907585860_907585866 18 Left 907585860 1:55617289-55617311 CCTTTACATATTGGCCAAGTCCC No data
Right 907585866 1:55617330-55617352 CATCATAAAATGCTCTTAAATGG No data
907585860_907585862 -9 Left 907585860 1:55617289-55617311 CCTTTACATATTGGCCAAGTCCC No data
Right 907585862 1:55617303-55617325 CCAAGTCCCTGATGTACAGTTGG No data
907585860_907585867 24 Left 907585860 1:55617289-55617311 CCTTTACATATTGGCCAAGTCCC No data
Right 907585867 1:55617336-55617358 AAAATGCTCTTAAATGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907585860 Original CRISPR GGGACTTGGCCAATATGTAA AGG (reversed) Intergenic
No off target data available for this crispr