ID: 907588534

View in Genome Browser
Species Human (GRCh38)
Location 1:55643525-55643547
Sequence CAGGCTTCTCCCTTCTCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907588530_907588534 1 Left 907588530 1:55643501-55643523 CCCTTGGTGATTGAACTCAATCT No data
Right 907588534 1:55643525-55643547 CAGGCTTCTCCCTTCTCGAGAGG No data
907588531_907588534 0 Left 907588531 1:55643502-55643524 CCTTGGTGATTGAACTCAATCTC No data
Right 907588534 1:55643525-55643547 CAGGCTTCTCCCTTCTCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907588534 Original CRISPR CAGGCTTCTCCCTTCTCGAG AGG Intergenic
No off target data available for this crispr