ID: 907588976

View in Genome Browser
Species Human (GRCh38)
Location 1:55647581-55647603
Sequence CCATTGGAACAGCAGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907588976_907588985 22 Left 907588976 1:55647581-55647603 CCCTGGGCCTGCTGTTCCAATGG No data
Right 907588985 1:55647626-55647648 ACCAGAGTCTTGGGCTTCTGTGG No data
907588976_907588982 12 Left 907588976 1:55647581-55647603 CCCTGGGCCTGCTGTTCCAATGG No data
Right 907588982 1:55647616-55647638 TCTGCCTCTTACCAGAGTCTTGG No data
907588976_907588987 30 Left 907588976 1:55647581-55647603 CCCTGGGCCTGCTGTTCCAATGG No data
Right 907588987 1:55647634-55647656 CTTGGGCTTCTGTGGAGCTAAGG No data
907588976_907588983 13 Left 907588976 1:55647581-55647603 CCCTGGGCCTGCTGTTCCAATGG No data
Right 907588983 1:55647617-55647639 CTGCCTCTTACCAGAGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907588976 Original CRISPR CCATTGGAACAGCAGGCCCA GGG (reversed) Intergenic
No off target data available for this crispr