ID: 907593095

View in Genome Browser
Species Human (GRCh38)
Location 1:55694376-55694398
Sequence CTGTAGAGTGGGAGGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907593089_907593095 4 Left 907593089 1:55694349-55694371 CCTGAGGCTCTTGGTCTGTTGCT No data
Right 907593095 1:55694376-55694398 CTGTAGAGTGGGAGGTTGGATGG No data
907593086_907593095 30 Left 907593086 1:55694323-55694345 CCATATCTTGCAACTCAATATGT No data
Right 907593095 1:55694376-55694398 CTGTAGAGTGGGAGGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907593095 Original CRISPR CTGTAGAGTGGGAGGTTGGA TGG Intergenic
No off target data available for this crispr