ID: 907593426

View in Genome Browser
Species Human (GRCh38)
Location 1:55697710-55697732
Sequence GTGCAGAAGAATAATGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907593426_907593428 1 Left 907593426 1:55697710-55697732 CCAAGATCATTATTCTTCTGCAC No data
Right 907593428 1:55697734-55697756 ATCACAGTAGCCACTTTAGTGGG No data
907593426_907593429 7 Left 907593426 1:55697710-55697732 CCAAGATCATTATTCTTCTGCAC No data
Right 907593429 1:55697740-55697762 GTAGCCACTTTAGTGGGCACTGG No data
907593426_907593430 10 Left 907593426 1:55697710-55697732 CCAAGATCATTATTCTTCTGCAC No data
Right 907593430 1:55697743-55697765 GCCACTTTAGTGGGCACTGGTGG No data
907593426_907593427 0 Left 907593426 1:55697710-55697732 CCAAGATCATTATTCTTCTGCAC No data
Right 907593427 1:55697733-55697755 TATCACAGTAGCCACTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907593426 Original CRISPR GTGCAGAAGAATAATGATCT TGG (reversed) Intergenic
No off target data available for this crispr