ID: 907596703

View in Genome Browser
Species Human (GRCh38)
Location 1:55726937-55726959
Sequence CCACTACCACAAGGAGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907596703_907596706 -10 Left 907596703 1:55726937-55726959 CCTCATTCTCCTTGTGGTAGTGG No data
Right 907596706 1:55726950-55726972 GTGGTAGTGGCCTTCTACCATGG No data
907596703_907596710 21 Left 907596703 1:55726937-55726959 CCTCATTCTCCTTGTGGTAGTGG No data
Right 907596710 1:55726981-55727003 GGAGTTGCCTTACCTTTTCGTGG No data
907596703_907596708 0 Left 907596703 1:55726937-55726959 CCTCATTCTCCTTGTGGTAGTGG No data
Right 907596708 1:55726960-55726982 CCTTCTACCATGGTTAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907596703 Original CRISPR CCACTACCACAAGGAGAATG AGG (reversed) Intergenic
No off target data available for this crispr