ID: 907597755

View in Genome Browser
Species Human (GRCh38)
Location 1:55735350-55735372
Sequence CCAGAGCCTTCACTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907597752_907597755 -4 Left 907597752 1:55735331-55735353 CCAAGTGGAGTCATGTTTCCCAG No data
Right 907597755 1:55735350-55735372 CCAGAGCCTTCACTGTGCTGAGG No data
907597751_907597755 -3 Left 907597751 1:55735330-55735352 CCCAAGTGGAGTCATGTTTCCCA No data
Right 907597755 1:55735350-55735372 CCAGAGCCTTCACTGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907597755 Original CRISPR CCAGAGCCTTCACTGTGCTG AGG Intergenic
No off target data available for this crispr