ID: 907602084

View in Genome Browser
Species Human (GRCh38)
Location 1:55782149-55782171
Sequence AGTTATCTGTAGATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907602082_907602084 4 Left 907602082 1:55782122-55782144 CCAAAAGACATCTATCAAAAGGA No data
Right 907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG No data
907602080_907602084 15 Left 907602080 1:55782111-55782133 CCAGTAGCAGTCCAAAAGACATC No data
Right 907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG No data
907602079_907602084 16 Left 907602079 1:55782110-55782132 CCCAGTAGCAGTCCAAAAGACAT No data
Right 907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907602084 Original CRISPR AGTTATCTGTAGATGATGGC AGG Intergenic
No off target data available for this crispr