ID: 907602967

View in Genome Browser
Species Human (GRCh38)
Location 1:55788546-55788568
Sequence CAGCAAAAAGCCATGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907602957_907602967 24 Left 907602957 1:55788499-55788521 CCCTGCCGTATCCAGAGGGGTGG No data
Right 907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG No data
907602961_907602967 13 Left 907602961 1:55788510-55788532 CCAGAGGGGTGGAAGTCAACAGT 0: 2
1: 8
2: 34
3: 98
4: 222
Right 907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG No data
907602960_907602967 19 Left 907602960 1:55788504-55788526 CCGTATCCAGAGGGGTGGAAGTC No data
Right 907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG No data
907602959_907602967 23 Left 907602959 1:55788500-55788522 CCTGCCGTATCCAGAGGGGTGGA No data
Right 907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907602967 Original CRISPR CAGCAAAAAGCCATGGTGGA CGG Intergenic
No off target data available for this crispr