ID: 907603105 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:55789631-55789653 |
| Sequence | CTGAATCACCAAAAGCAAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907603105_907603108 | 5 | Left | 907603105 | 1:55789631-55789653 | CCAACTTGCTTTTGGTGATTCAG | No data | ||
| Right | 907603108 | 1:55789659-55789681 | CCACTTGGCCCCTGCCACTGTGG | No data | ||||
| 907603105_907603106 | -10 | Left | 907603105 | 1:55789631-55789653 | CCAACTTGCTTTTGGTGATTCAG | No data | ||
| Right | 907603106 | 1:55789644-55789666 | GGTGATTCAGTGTTGCCACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907603105 | Original CRISPR | CTGAATCACCAAAAGCAAGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||