ID: 907603105

View in Genome Browser
Species Human (GRCh38)
Location 1:55789631-55789653
Sequence CTGAATCACCAAAAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907603105_907603108 5 Left 907603105 1:55789631-55789653 CCAACTTGCTTTTGGTGATTCAG No data
Right 907603108 1:55789659-55789681 CCACTTGGCCCCTGCCACTGTGG No data
907603105_907603106 -10 Left 907603105 1:55789631-55789653 CCAACTTGCTTTTGGTGATTCAG No data
Right 907603106 1:55789644-55789666 GGTGATTCAGTGTTGCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907603105 Original CRISPR CTGAATCACCAAAAGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr