ID: 907603521

View in Genome Browser
Species Human (GRCh38)
Location 1:55793800-55793822
Sequence GGATGCACACTCTGTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907603513_907603521 23 Left 907603513 1:55793754-55793776 CCAGCTGCGGCAGGAAGGTGCAG No data
Right 907603521 1:55793800-55793822 GGATGCACACTCTGTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907603521 Original CRISPR GGATGCACACTCTGTGGAGC TGG Intergenic
No off target data available for this crispr