ID: 907606003

View in Genome Browser
Species Human (GRCh38)
Location 1:55818137-55818159
Sequence ATTACCTATCCCCATTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907605996_907606003 28 Left 907605996 1:55818086-55818108 CCCTTTTAACTATGAAGAGCACA No data
Right 907606003 1:55818137-55818159 ATTACCTATCCCCATTGTGTGGG No data
907605997_907606003 27 Left 907605997 1:55818087-55818109 CCTTTTAACTATGAAGAGCACAA No data
Right 907606003 1:55818137-55818159 ATTACCTATCCCCATTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907606003 Original CRISPR ATTACCTATCCCCATTGTGT GGG Intergenic
No off target data available for this crispr