ID: 907612056

View in Genome Browser
Species Human (GRCh38)
Location 1:55881226-55881248
Sequence GTGTTCATTGCTTATCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907612053_907612056 14 Left 907612053 1:55881189-55881211 CCTCTCAACAACATATAAGACTA No data
Right 907612056 1:55881226-55881248 GTGTTCATTGCTTATCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907612056 Original CRISPR GTGTTCATTGCTTATCAGAT TGG Intergenic
No off target data available for this crispr