ID: 907612524

View in Genome Browser
Species Human (GRCh38)
Location 1:55886874-55886896
Sequence TGCCTTGTGCTCTGACTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907612514_907612524 12 Left 907612514 1:55886839-55886861 CCAGAAAGTATCTTAGCTTCACC No data
Right 907612524 1:55886874-55886896 TGCCTTGTGCTCTGACTGAGGGG No data
907612516_907612524 -9 Left 907612516 1:55886860-55886882 CCCCCGGTCCCTTGTGCCTTGTG No data
Right 907612524 1:55886874-55886896 TGCCTTGTGCTCTGACTGAGGGG No data
907612513_907612524 13 Left 907612513 1:55886838-55886860 CCCAGAAAGTATCTTAGCTTCAC No data
Right 907612524 1:55886874-55886896 TGCCTTGTGCTCTGACTGAGGGG No data
907612517_907612524 -10 Left 907612517 1:55886861-55886883 CCCCGGTCCCTTGTGCCTTGTGC No data
Right 907612524 1:55886874-55886896 TGCCTTGTGCTCTGACTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907612524 Original CRISPR TGCCTTGTGCTCTGACTGAG GGG Intergenic
No off target data available for this crispr