ID: 907617986

View in Genome Browser
Species Human (GRCh38)
Location 1:55944220-55944242
Sequence CTGTAGCCAAAAATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907617977_907617986 29 Left 907617977 1:55944168-55944190 CCTGGAACAGCGTGAGCAGTGTA No data
Right 907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG No data
907617982_907617986 5 Left 907617982 1:55944192-55944214 CCTTGGAAAAGGGTGCACCTGGC No data
Right 907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907617986 Original CRISPR CTGTAGCCAAAAATGGAGAA AGG Intergenic
No off target data available for this crispr