ID: 907618317

View in Genome Browser
Species Human (GRCh38)
Location 1:55948161-55948183
Sequence CACAGTAAGGAAATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907618317_907618324 17 Left 907618317 1:55948161-55948183 CCTGCCTCCATTTCCTTACTGTG No data
Right 907618324 1:55948201-55948223 CAGAGTTTCACATTACTCAAAGG No data
907618317_907618325 18 Left 907618317 1:55948161-55948183 CCTGCCTCCATTTCCTTACTGTG No data
Right 907618325 1:55948202-55948224 AGAGTTTCACATTACTCAAAGGG No data
907618317_907618326 19 Left 907618317 1:55948161-55948183 CCTGCCTCCATTTCCTTACTGTG No data
Right 907618326 1:55948203-55948225 GAGTTTCACATTACTCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907618317 Original CRISPR CACAGTAAGGAAATGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr