ID: 907621900 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:55990032-55990054 |
| Sequence | CTACATAACCAGAGAAAGTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907621896_907621900 | -2 | Left | 907621896 | 1:55990011-55990033 | CCAGGATCATAAGAAAATCCCCT | No data | ||
| Right | 907621900 | 1:55990032-55990054 | CTACATAACCAGAGAAAGTGAGG | No data | ||||
| 907621895_907621900 | 10 | Left | 907621895 | 1:55989999-55990021 | CCAGGATGTCTTCCAGGATCATA | No data | ||
| Right | 907621900 | 1:55990032-55990054 | CTACATAACCAGAGAAAGTGAGG | No data | ||||
| 907621894_907621900 | 11 | Left | 907621894 | 1:55989998-55990020 | CCCAGGATGTCTTCCAGGATCAT | No data | ||
| Right | 907621900 | 1:55990032-55990054 | CTACATAACCAGAGAAAGTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907621900 | Original CRISPR | CTACATAACCAGAGAAAGTG AGG | Intergenic | ||
| No off target data available for this crispr | |||||