ID: 907621900

View in Genome Browser
Species Human (GRCh38)
Location 1:55990032-55990054
Sequence CTACATAACCAGAGAAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907621896_907621900 -2 Left 907621896 1:55990011-55990033 CCAGGATCATAAGAAAATCCCCT No data
Right 907621900 1:55990032-55990054 CTACATAACCAGAGAAAGTGAGG No data
907621895_907621900 10 Left 907621895 1:55989999-55990021 CCAGGATGTCTTCCAGGATCATA No data
Right 907621900 1:55990032-55990054 CTACATAACCAGAGAAAGTGAGG No data
907621894_907621900 11 Left 907621894 1:55989998-55990020 CCCAGGATGTCTTCCAGGATCAT No data
Right 907621900 1:55990032-55990054 CTACATAACCAGAGAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907621900 Original CRISPR CTACATAACCAGAGAAAGTG AGG Intergenic
No off target data available for this crispr