ID: 907623011

View in Genome Browser
Species Human (GRCh38)
Location 1:56001268-56001290
Sequence GCTTGTTTTCCATGAATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907623011_907623020 23 Left 907623011 1:56001268-56001290 CCAGACATTCATGGAAAACAAGC No data
Right 907623020 1:56001314-56001336 AGGAAGGAAGGTATATACCCTGG No data
907623011_907623019 11 Left 907623011 1:56001268-56001290 CCAGACATTCATGGAAAACAAGC No data
Right 907623019 1:56001302-56001324 AAGTGGGTAAGAAGGAAGGAAGG No data
907623011_907623015 -5 Left 907623011 1:56001268-56001290 CCAGACATTCATGGAAAACAAGC No data
Right 907623015 1:56001286-56001308 CAAGCTGGCCAAAGGAAAGTGGG No data
907623011_907623017 3 Left 907623011 1:56001268-56001290 CCAGACATTCATGGAAAACAAGC No data
Right 907623017 1:56001294-56001316 CCAAAGGAAAGTGGGTAAGAAGG No data
907623011_907623018 7 Left 907623011 1:56001268-56001290 CCAGACATTCATGGAAAACAAGC No data
Right 907623018 1:56001298-56001320 AGGAAAGTGGGTAAGAAGGAAGG No data
907623011_907623014 -6 Left 907623011 1:56001268-56001290 CCAGACATTCATGGAAAACAAGC No data
Right 907623014 1:56001285-56001307 ACAAGCTGGCCAAAGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907623011 Original CRISPR GCTTGTTTTCCATGAATGTC TGG (reversed) Intergenic
No off target data available for this crispr