ID: 907623019

View in Genome Browser
Species Human (GRCh38)
Location 1:56001302-56001324
Sequence AAGTGGGTAAGAAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907623011_907623019 11 Left 907623011 1:56001268-56001290 CCAGACATTCATGGAAAACAAGC No data
Right 907623019 1:56001302-56001324 AAGTGGGTAAGAAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907623019 Original CRISPR AAGTGGGTAAGAAGGAAGGA AGG Intergenic
No off target data available for this crispr