ID: 907632176

View in Genome Browser
Species Human (GRCh38)
Location 1:56093673-56093695
Sequence TTACCTGAGGGGAAATGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907632176_907632182 -5 Left 907632176 1:56093673-56093695 CCAGCCCATTTCCCCTCAGGTAA No data
Right 907632182 1:56093691-56093713 GGTAAGTTAATTCTGTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907632176 Original CRISPR TTACCTGAGGGGAAATGGGC TGG (reversed) Intergenic
No off target data available for this crispr