ID: 907632665

View in Genome Browser
Species Human (GRCh38)
Location 1:56098833-56098855
Sequence CTGTTATCATTTTTCACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907632665_907632667 26 Left 907632665 1:56098833-56098855 CCTGTGGTGAAAAATGATAACAG No data
Right 907632667 1:56098882-56098904 ATGCTGACTAGAAGCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907632665 Original CRISPR CTGTTATCATTTTTCACCAC AGG (reversed) Intergenic
No off target data available for this crispr