ID: 907636313

View in Genome Browser
Species Human (GRCh38)
Location 1:56137944-56137966
Sequence ATCAGGGATGACCATACACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907636313_907636316 2 Left 907636313 1:56137944-56137966 CCTCGTGTATGGTCATCCCTGAT No data
Right 907636316 1:56137969-56137991 CATCTCCCCCTCCACACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907636313 Original CRISPR ATCAGGGATGACCATACACG AGG (reversed) Intergenic
No off target data available for this crispr