ID: 907639400

View in Genome Browser
Species Human (GRCh38)
Location 1:56170932-56170954
Sequence CTGGAGGCACAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907639390_907639400 20 Left 907639390 1:56170889-56170911 CCCAGAGATTAGTAACTTCAGGA No data
Right 907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG No data
907639391_907639400 19 Left 907639391 1:56170890-56170912 CCAGAGATTAGTAACTTCAGGAA No data
Right 907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907639400 Original CRISPR CTGGAGGCACAGAAGGATGG AGG Intergenic
No off target data available for this crispr