ID: 907639907

View in Genome Browser
Species Human (GRCh38)
Location 1:56177907-56177929
Sequence TATCCAGAGCTGCCCCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907639907_907639910 25 Left 907639907 1:56177907-56177929 CCAGTTTGGGGCAGCTCTGGATA No data
Right 907639910 1:56177955-56177977 AATTTGGTTTCCATTTCTCTTGG No data
907639907_907639909 9 Left 907639907 1:56177907-56177929 CCAGTTTGGGGCAGCTCTGGATA No data
Right 907639909 1:56177939-56177961 AGGTATTTTTATGAACAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907639907 Original CRISPR TATCCAGAGCTGCCCCAAAC TGG (reversed) Intergenic
No off target data available for this crispr