ID: 907643685

View in Genome Browser
Species Human (GRCh38)
Location 1:56219020-56219042
Sequence ACAGCCCAGAAGGGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907643681_907643685 1 Left 907643681 1:56218996-56219018 CCAAAAGTAAGAATATCAGAGAA No data
Right 907643685 1:56219020-56219042 ACAGCCCAGAAGGGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907643685 Original CRISPR ACAGCCCAGAAGGGGAAAGA AGG Intergenic
No off target data available for this crispr