ID: 907644555

View in Genome Browser
Species Human (GRCh38)
Location 1:56229285-56229307
Sequence ACAAGGCCCCTCTTGGGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907644549_907644555 8 Left 907644549 1:56229254-56229276 CCCATTAAACTGTCTGCTCTTTC No data
Right 907644555 1:56229285-56229307 ACAAGGCCCCTCTTGGGTCGTGG No data
907644550_907644555 7 Left 907644550 1:56229255-56229277 CCATTAAACTGTCTGCTCTTTCC No data
Right 907644555 1:56229285-56229307 ACAAGGCCCCTCTTGGGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907644555 Original CRISPR ACAAGGCCCCTCTTGGGTCG TGG Intergenic
No off target data available for this crispr