ID: 907645411

View in Genome Browser
Species Human (GRCh38)
Location 1:56237440-56237462
Sequence AACTATCTGGAGTTTCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907645401_907645411 16 Left 907645401 1:56237401-56237423 CCTCGTCTATAAAATGGGGTTAA No data
Right 907645411 1:56237440-56237462 AACTATCTGGAGTTTCGGGGTGG No data
907645400_907645411 19 Left 907645400 1:56237398-56237420 CCTCCTCGTCTATAAAATGGGGT No data
Right 907645411 1:56237440-56237462 AACTATCTGGAGTTTCGGGGTGG No data
907645402_907645411 -10 Left 907645402 1:56237427-56237449 CCCACACCCTGCCAACTATCTGG No data
Right 907645411 1:56237440-56237462 AACTATCTGGAGTTTCGGGGTGG No data
907645396_907645411 25 Left 907645396 1:56237392-56237414 CCTAAGCCTCCTCGTCTATAAAA No data
Right 907645411 1:56237440-56237462 AACTATCTGGAGTTTCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907645411 Original CRISPR AACTATCTGGAGTTTCGGGG TGG Intergenic